Supplementary Materialscells-09-00374-s001. when overexpressed TPX2 can connect to Aurora-A. Furthermore, we Fzd4 explain a peculiar, and Aurora-A-interaction-independent, phenotype in telophase cells, with aberrantly steady microtubules interfering with nuclear reconstitution as well as the set up of a continuing lamin B1 network, leading to daughter cells showing doughnut-shaped nuclei. Our outcomes using non-transformed cells therefore reveal a previously uncharacterised outcome of abnormally high TPX2 amounts on the right microtubule cytoskeleton remodelling and G1 nuclei reformation, in the mitosis-to-interphase changeover. egg components [10,11]. The function of TPX2 in spindle set up also requires the recruitment of particular elements to MTs: besides Xklp2, TPX2 binds Eg5 using its C-terminus, contributing to localise it to MTs and influencing its motor activity [12,13]. Moreover, the N-terminus binds the Aurora-A kinase and mediates its localisation at spindle MTs [14,15]. TPX2 binding also importantly contributes to Aurora-A kinase activation [16,17,18] and stability [19]. The first 43 amino acids of TPX2 have been described as the region required for Aurora-A binding [16] and deletions within this region have been previously shown to impair Aurora-A/TPX2 interaction and TPX2 regulation of Aurora-A [19,20]. Altogether, TPX2 diversified functions justify the observations that its RNA-interference (RNAi)-mediated inactivation in human cells strongly impairs bipolar spindle assembly and mitotic progression, arresting cells at the prometaphase stage [15,21,22]. Similar results were obtained in a mouse model, where lack of TPX2 induced early embryonic lethality and TPX2-deficient mouse embryonic fibroblasts transiently arrested in prometaphase with abnormally assembled spindles and less stable K-fibres, and eventually exited mitosis without chromosome segregation [23]. Experiments in human tumour cells showed that TPX2 overexpression also affects spindle assembly [21,24]. Several tumours overexpress TPX2 [2,25,26,27], often within signatures of mitotic genes, frequently including Aurora-A [25,28,29]. Therefore, cancer cell lines may already display deregulated levels of mitotic factors [30] and the actual effect of increased TPX2 levels on an unperturbed mitosis would be more precisely addressed using non-cancer cells. In the present study, we analysed the consequences of TPX2 overexpression on the mitotic process in a non-transformed cellular background, discriminating their dependency on Aurora-A interaction. We do observe spindle assembly defects and impaired progression through mitosis. Unexpectedly, excess TPX2, independent of its ability to interact with Aurora-A, affected spindle disassembly and nuclear reformation at mitotic exit, resulting in doughnut-shaped nuclei and defective assembly of the lamin B1 network. These results link TPX2 overexpression to defective chromatin organisation and loss of nuclear envelope (NE) integrity and highlight the importance of controlling TPX2 levels at ana-telophase for a correct mitosis-to-interphase transition. 2. Materials and Methods 2.1. Plasmid Generation The plasmids epB-Bsd-TT-VENUS and epB-Puro-TT-FLAG-TPX2 were generated by inserting the coding series of VENUS (excised through the pVENUS-N1_AURKA plasmid [31]), FLAG-TPX2 (amplified through the plasmid pEGFP-TPX2res [19] using the oligos AN2728 BamHI_FLAG_TPX2_Fw: GGCGGATCCATGGACTACAAGGACGACGATGACAAGATGTCACAAGTTAAAAGCTC; and NotI_TPX2_Rv: CAGCGGCCGCTTAGCAGTGGAATCGAGTGG) in to the BamHI and NotI sites AN2728 from the improved piggyBac transposable vectors epB-Bsd-TT and epB-Puro-TT [32]. For era from the epB-Puro-TT-FLAG-43TPX2 plasmid, the put AN2728 in FLAG-43TPX2 was made by PCR through the plasmid epB-Puro-TT-FLAG-TPX2 using the oligos BamHI_FLAG_TPX243_Fw (GGCGGATCCATGGACTACAAGGACGACGATGACAAGAAGTTACTGGGGAAGAATG) and NotI_TPX2_Rv. The FLAG-43TPX2 series was then put in to the BamHI and NotI sites from the improved piggyBac transposable vector epB-Puro-TT [32]. 2.2. Era of Steady Cell Lines Steady transgenic hTERT RPE-1 cell lines had been generated by transfection of the plasmid encoding the piggyBac transposase as well as inducible vectors for manifestation of VENUS only (epB-Bsd-TT-VENUS), FLAG-TPX2 complete size/VENUS (epB-Puro-TT-FLAG-TPX2 and epB-Bsd-TT-VENUS), FLAG-43TPX2/VENUS (epB-Puro-TT-FLAG-43TPX2 and epB-Bsd-TT-VENUS) or FLAG-43TPX2 only (epB-Puro-TT-FLAG-43TPX2 and epB-Bsd-TT). Transfection was performed using Lipofectamine LTX (Invitrogen, Carlsbad, CA, USA). After that, 48 h after transfection, selection with blasticidin-S hydrochloride and puromycin (both 9 g/mL; Sigma-Aldrich, St Louis, MO, USA) was used. Resistant cells had been propagated like a pool, and manifestation of exogenous proteins after administration of just one 1 g/mL doxycycline hyclate (dox, tetracycline analogue; Santa.